Please wait a minute...
Reviews in Cardiovascular Medicine  2021, Vol. 22 Issue (3): 1037-1045     DOI: 10.31083/j.rcm2203113
Special Issue: State-of-the-Art Cardiovascular Medicine in Asia 2021
Original Research Previous articles | Next articles
Histone deacetylase inhibitor, mocetinostat, regulates cardiac remodelling and renin-angiotensin system activity in rats with transverse aortic constriction-induced pressure overload cardiac hypertrophy
Gun Jik Kim1, Hanna Jung1, Eunjo Lee2, Sung Woon Chung3, *()
1Department of Thoracic and Cardiovascular Surgery, Kyungpook National University Hospital, School of Medicine, Kyungpook National University, 41944 Daegu, Republic of Korea
2Emerging Infectious Disease Vaccines Division, National Institute of Food and Drug Safety Evaluation, Ministry of Food and Drug Safety, 28159 Cheongju, Republic of Korea
3Department of Thoracic and Cardiovascular Surgery, Pusan National University Hospital, Pusan National University School of Medicine, 49241 Busan, Republic of Korea
Download:  PDF(4121KB)  ( 327 ) Full text   ( 5 )
Export:  BibTeX | EndNote (RIS)      
Abstract:

Histone deacetylase (HDAC) inhibitors have shown cardioprotective or renoprotective effects in various animal models. Our study proposed that the HDAC inhibitor, mocetinostat, regulates cardiac remodelling and renin-angiotensin system (RAS) activity in rats with transverse aortic constriction (TAC)-induced pressure overload cardiac hypertrophy. Cardiac remodelling was evaluated using echocardiography. Cardiac hypertrophy was visualized with haematoxylin and eosin staining, and related gene (Nppa and Nppb) expression was quantified by quantitative real-time polymerase chain reaction (qRT-PCR). Cardiac and renal fibrosis were visualized with picrosirius red and trichrome staining, respectively. Fibrosis related gene (Collagen-1, Collagen-3, Ctgf, and Fibronectin) expression was determined by qRT-PCR. Serum concentrations of RAS components (renin, angiotensin II, and aldosterone) were quantified by enzyme-linked immunosorbent assay and related gene (Renin and Agtr1) expression was determined by qRT-PCR. TAC-induced pressure overload cardiac hypertrophy, which mimics hypertensive heart disease, increased cardiac remodelling, cardiac hypertrophy, and fibrosis in our rat models. Upon treatment with mocetinostat, there was a significant regression in cardiac remodelling, cardiac hypertrophy, and fibrosis in TAC rats. Additionally, pressure overload-induced renal fibrosis and activity of RAS-related components were increased in TAC rats, and were decreased on treatment with mocetinostat. The present study indicates that mocetinostat, an HDAC inhibitor, has cardiorenal protective effects in rats with TAC-induced pressure overload cardiac hypertrophy and offers a promising therapeutic agent for hypertension-related diseases.

Key words:  Animal model      Fibrosis      Heart      Histone deacetylase      Hypertension      Hypertrophy      Kidney     
Submitted:  05 July 2021      Revised:  17 August 2021      Accepted:  20 August 2021      Published:  24 September 2021     
*Corresponding Author(s):  Sung Woon Chung     E-mail:  sungwoon@pusan.ac.kr

Cite this article: 

Gun Jik Kim, Hanna Jung, Eunjo Lee, Sung Woon Chung. Histone deacetylase inhibitor, mocetinostat, regulates cardiac remodelling and renin-angiotensin system activity in rats with transverse aortic constriction-induced pressure overload cardiac hypertrophy. Reviews in Cardiovascular Medicine, 2021, 22(3): 1037-1045.

URL: 

https://rcm.imrpress.com/EN/10.31083/j.rcm2203113     OR     https://rcm.imrpress.com/EN/Y2021/V22/I3/1037

Table 1.   Primers for quantitative real-time polymerase chain reaction.
Gene (Accession No.) Primer sequence (5 to 3)
Nppa (NM_012612) F: ATCTGATGGATTTCAAGAACC
R: CTCTGAGACGGGTTGACTTC
Nppb (NM_031545) F: ACAATCCACGATGCAGAAGCT
R: GGGCCTTGGTCCTTTGAGA
Collagen-1 (NM_053304) F: GTCGAGGGCCAAGACGAAG
R: CAGATCACGTCATCGCACAAC
Collagen-3 (NM_032085) F: CTGGTCCTGTTGGTCCATCT
R: ACCTTTGTCACCTCGTGGAC
Ctgf (NM_022266) F: TCCCGTTAGCCTCGCCTTGG
R: CGGTACACGGACCCACCGAA
Fibronectin (NM_019143) F: AGCAAATCGTGCAGCCTCCG
R: CCCCCTTCATGGCAGCGATT
Renin (NM_012642) F: GTAACTGTGGGTGGAATCATTGTG
R: TGGGAGAGAATGTGGTCGAAGA
Agtr1 (NM_030985.4) F: GGAGAGGATTCGTGGCTTGAG
R: CTTTCTGGGAGGGTTGTGTGAT
Gapdh (NM_017008) F: TGCACCACCAACTGCTTAG
R: GATGCAGGGATGATGTTC
Fig. 1.  Effect of mocetinostat on physical measurements in rats after transverse aortic constriction (TAC)-induced pressure overload. (a) Systolic blood pressure (SBP) was estimated for five weeks. Treatment with mocetinostat reduced the blood pressure induced by TAC. (b) Body weight was estimated for four weeks. The body weight was not affected in any of the four groups.
#, p < 0.05 vs. TAC group; **, p < 0.01 vs. sham group.

Fig. 2.  Effect of mocetinostat on cardiac remodelling in rats after TAC-induced pressure overload. (a,b) Left ventricular remodelling were evaluated by echocardiography. The thickness of interventricular septum (IVS, a) and left ventricular posterior wall (LVPW, b) were estimated. Treatment of mocetinostat suppressed TAC-induced cardiac remodelling. Cardiac hypertrophy was estimated by the weight/tibia length ratio of the heart. The weight/tibia length ratios of the heart (c) and left heart (d) were increased in TAC group compared with those in sham group. The administration with mocetinostat restored the weight/tibia length ratios of the heart (c) and left heart (d). Mocetinostat administration did not affect the weight/tibia length ratios of the right heart (e).
*, p < 0.05 vs. sham; #, p < 0.05 vs. TAC group; **, p < 0.01 vs. sham group.

Fig. 3.  Effect of mocetinostat on cardiac hypertrophy in rats after TAC-induced pressure overload. Histological observation of the hearts was acheived by haematoxylin and eosin staining. The hypertrophy of the cardiomyocytes (a,b) were increased in TAC group compared with those in sham group, which were moderated by mocetinostat administration. Scale bar shows 50 μm (a). The level of Nppa (c) and Nppb (d) mRNA, cardiac hypertrophy markers, was increased in TAC group, which was decreased by mocetinostat treatment.
*, p < 0.05 vs. sham; #, p < 0.05 vs. TAC group; **, p < 0.01 vs. sham group; ##, p < 0.01 vs. TAC group.

Fig. 4.  Effect of mocetinostat on cardiac fibrosis in rats after TAC-induced pressure overload. Histological observation of the hearts was acheived by picrosirius red staining. TAC group presented increase of collagen accumulation and fibrosis of the myocardium (a, red stain) when compared with those in sham group. Mocetinostat administration moderated cardiac fibrosis in TAC plus mocetinostat group. Scale bar shows 50 μm (a). The level of Collagen-1 (b), Collagen-3 (c), Ctgf (d) and Fibronectin (e) mRNA, cardiac fibrosis markers, was increased in TAC group, which was then decreased by mocetinostat treatment.
*, p < 0.05 vs. sham; #, p < 0.05 vs. TAC group.

Fig. 5.  Effect of mocetinostat on renal fibrosis in rats after TAC-induced pressure overload. Histological observation of the kidneys was achieved using haematoxylin and eosin (a), and trichrome (b) staining. TAC group presented increase of collagen accumulation and fibrosis (b, blue stain) when compared with those in sham group. Mocetinostat administration moderated renal fibrosis in TAC plus mocetinostat group. Scale bars show 50 μm (a). TAC group exhibited increased expression of Collagen-1 (c), Collagen-3 (d), Ctgf (e) and Fibronectin (f) mRNA, renal fibrosis markers, which was attenuated by mocetinostat treatment.
*, p < 0.05 vs. sham; #, p < 0.05 vs. TAC group.

Fig. 6.  Effect of mocetinostat on the renin-angiotensin system in rats after TAC-induced pressure overload. Serum concentration of renin, angiotensin II, and aldosterone were measured. Renin (a), angiotensin II (b), and aldosterone (c) were significantly increased in TAC group compared with sham group, and mocetinostat considerably regulated these concentrations in TAC group. TAC group had increased Renin (d) and Agtr1 (e) mRNA expression, which decreased with mocetinostat administration.
*, p < 0.05 vs. sham; #, p < 0.05 vs. TAC group; **, p < 0.01 vs. sham group; ##, p < 0.01 vs. TAC group.

[1] Yildiz M, Oktay AA, Stewart MH, Milani RV, Ventura HO, Lavie CJ. Left ventricular hypertrophy and hypertension. Progress in Cardiovascular Diseases. 2020; 63: 10–21.
[2] Jung H, Lee E, Kim I, Song JH, Kim GJ. Histone deacetylase inhibition has cardiac and vascular protective effects in rats with pressure overload cardiac hypertrophy. Physiological Research. 2019; 68: 727–737.
[3] Taddei S, Nami R, Bruno RM, Quatrini I, Nuti R. Hypertension, left ventricular hypertrophy and chronic kidney disease. Heart Failure Reviews. 2011; 16: 615–620.
[4] Leoncini G, Viazzi F, Parodi D, Vettoretti S, Ratto E, Ravera M, et al. Mild renal dysfunction and subclinical cardiovascular damage in primary hypertension. Hypertension. 2003; 42: 14–18.
[5] Amann K, Rychlik I, Miltenberger-Milteny G, Ritz E. Left ventricular hypertrophy in renal failure. Kidney International Supplements. 1998; 68: S78–S85.
[6] Williams SM, Golden-Mason L, Ferguson BS, Schuetze KB, Cavasin MA, Demos-Davies K, et al. Class I HDACs regulate angiotensin II-dependent cardiac fibrosis via fibroblasts and circulating fibrocytes. Journal of Molecular and Cellular Cardiology. 2014; 67: 112–125.
[7] Yoon GE, Jung JK, Lee YH, Jang BC, In Kim J. Histone deacetylase inhibitor CG200745 ameliorates high-fat diet-induced hypertension via inhibition of angiotensin II production. Naunyn-Schmiedeberg’s Archives of Pharmacology. 2020; 393: 491–500.
[8] Tang J, Yan H, Zhuang S. Histone deacetylases as targets for treatment of multiple diseases. Clinical Science. 2013; 124: 651–662.
[9] Jung H, Lee E, Kim I, Kim GJ. Histone Deacetylase Inhibition Attenuates Aortic Remodeling in Rats under Pressure Overload. BioMed Research International. 2020; 2020: 4705615.
[10] Kee HJ, Bae EH, Park S, Lee KE, Suh SH, Kim SW, et al. HDAC inhibition suppresses cardiac hypertrophy and fibrosis in DOCA-salt hypertensive rats via regulation of HDAC6/HDAC8 enzyme activity. Kidney and Blood Pressure Research. 2013; 37: 229–239.
[11] Iyer A, Fenning A, Lim J, Le GT, Reid RC, Halili MA, et al. Antifibrotic activity of an inhibitor of histone deacetylases in DOCA-salt hypertensive rats. British Journal of Pharmacology. 2010; 159: 1408–1417.
[12] Lee E, Song MJ, Lee HA, Kang SH, Kim M, Yang EK, et al. Histone deacetylase inhibitor, CG200745, attenuates cardiac hypertrophy and fibrosis in DOCA-induced hypertensive rats. The Korean Journal of Physiology & Pharmacology. 2016; 20: 477–485.
[13] Kee HJ, Sohn IS, Nam KI, Park JE, Qian YR, Yin Z, et al. Inhibition of histone deacetylation blocks cardiac hypertrophy induced by angiotensin II infusion and aortic banding. Circulation. 2006; 113: 51–59.
[14] Wu WP, Tsai YG, Lin TY, Wu MJ, Lin CY. The attenuation of renal fibrosis by histone deacetylase inhibitors is associated with the plasticity of FOXP3(+)IL-17(+) T cells. BMC Nephrology. 2017; 18: 225.
[15] Choi HS, Song JH, Kim IJ, Joo SY, Eom GH, Kim I, et al. Histone deacetylase inhibitor, CG200745 attenuates renal fibrosis in obstructive kidney disease. Scientific Reports. 2018; 8: 11546.
[16] Boumber Y, Younes A, Garcia-Manero G. Mocetinostat (MGCD0103): a review of an isotype-specific histone deacetylase inhibitor. Expert Opinion on Investigational Drugs. 2011; 20: 823–829.
[17] Lyu X, Hu M, Peng J, Zhang X, Sanders YY. HDAC inhibitors as antifibrotic drugs in cardiac and pulmonary fibrosis. Therapeutic Advances in Chronic Disease. 2019; 10: 1–9.
[18] Rockman HA, Ross RS, Harris AN, Knowlton KU, Steinhelper ME, Field LJ, et al. Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proceedings of the National Academy of Sciences of the United States of America. 1991; 88: 8277–8281.
[19] Cavasin MA, Demos-Davies K, Horn TR, Walker LA, Lemon DD, Birdsey N, et al. Selective class I histone deacetylase inhibition suppresses hypoxia-induced cardiopulmonary remodeling through an antiproliferative mechanism. Circulation Research. 2012; 110: 739–748.
[20] Nural-Guvener HF, Zakharova L, Nimlos J, Popovic S, Mastroeni D, Gaballa MA. HDAC class I inhibitor, Mocetinostat, reverses cardiac fibrosis in heart failure and diminishes CD90+ cardiac myofibroblast activation. Fibrogenesis & Tissue Repair. 2014; 7: 10.
[21] Munoz-Durango N, Fuentes CA, Castillo AE, Gonzalez-Gomez LM, Vecchiola A, Fardella CE, et al. Role of the Renin-Angiotensin-Aldosterone System beyond Blood Pressure Regulation: Molecular and Cellular Mechanisms Involved in End-Organ Damage during Arterial Hypertension. International Journal of Molecular Sciences. 2016; 17: 797.
[22] Mennuni S, Rubattu S, Pierelli G, Tocci G, Fofi C, Volpe M. Hypertension and kidneys: unraveling complex molecular mechanisms underlying hypertensive renal damage. Journal of Human Hypertension. 2014; 28: 74–79.
[23] Sun HJ. Current Opinion for Hypertension in Renal Fibrosis. Advances in Experimental Medicine and Biology. 2019; 1165: 37–47.
[24] Khan S, Jena G, Tikoo K. Sodium valproate ameliorates diabetes-induced fibrosis and renal damage by the inhibition of histone deacetylases in diabetic rat. Experimental and Molecular Pathology. 2015; 98: 230–239.
[25] Ryu Y, Kee HJ, Sun S, Seok YM, Choi SY, Kim GR, et al. Class I histone deacetylase inhibitor MS-275 attenuates vasoconstriction and inflammation in angiotensin II-induced hypertension. PLoS ONE. 2019; 14: e0213186.
[26] Kee HJ, Ryu Y, Seok YM, Choi SY, Sun S, Kim GR, et al. Selective inhibition of histone deacetylase 8 improves vascular hypertrophy, relaxation, and inflammation in angiotensin II hypertensive mice. Clinical Hypertension. 2019; 25: 13.
[1] Luca Di Lullo, Antonio Bellasi, Vincenzo Barbera, Claudio Ronco. Cardionephrology and cardiorenal disease in Italy: state of the art[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 563-572.
[2] Hongbo Gan, Heng Tang, Yujie Huang, Dan Wang, Peng Pu, Zhong Zuo. The 'diamond' approach to personalized drug treatment of heart failure with reduced ejection fraction[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 573-584.
[3] Ronald O. Morales, Francesc Barbosa, Nuria Farre. Peritoneal dialysis in heart failure: focus on kidney and ventricular dysfunction[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 649-657.
[4] Matteo Beltrami, Simone Bartolini, Massimo Milli, Alberto Palazzuoli. The relevance of specific heart failure outpatient programs in the COVID era: an appropriate model for every disease[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 677-690.
[5] Sarah Fitzsimons, Robert N Doughty. Role of transthoracic echocardiogram in acute heart failure[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 741-754.
[6] Guinan Xie, An Yan, Peng Lin, Yi Wang, Liping Guo. Trimethylamine N-oxide—a marker for atherosclerotic vascular disease[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 787-797.
[7] Alexandru Burlacu, Crischentian Brinza, Adrian Brezulianu, Adrian Covic. Accurate and early detection of sleepiness, fatigue and stress levels in drivers through Heart Rate Variability parameters: a systematic review[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 845-852.
[8] Martha Kyriakou, Anastasia Samara, Katerina Philippou, Ioanna Lakatamitou, Ekaterini Lambrinou. A qualitative meta-synthesis of patients with heart failure perceived needs[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 853-864.
[9] Yaowang Lin, Yang Chen, Jie Yuan, Xinli Pang, Huadong Liu, Shaohong Dong, Qiuling Chen. Intravenous morphine use in acute heart failure increases adverse outcomes: a meta-analysis[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 865-872.
[10] Na Ta, Mengwei Liu, Yue Wang, Fanxin Zeng, Fangfang Nie, Mengke Shang, Xiaotong Wang, Yuetian Yang, Man Liang, Lu Wen, Lanxin Ou, Zhibin Yang, Wanyang Liu, Xiuping Liu. Association of polymorphisms in endothelial dysfunction-related genes with susceptibility to essential hypertension in elderly Han population in Liaoning province, China[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 895-901.
[11] Ali Yazdanyar, Muhammad Haisum Maqsood, Jerald Pelayo, Julien Sanon, Eduardo Quintero, Kevin Bryan Lo, Roy O. Mathew, Janani Rangaswami. Clinical outcomes in patients with heart failure with and without cirrhosis: an analysis from the national inpatient sample[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 925-929.
[12] Amir Youssari, Jean-Paul Couetil, Mariantonietta Piscitelli, Céline Zerbib, Ophélie Brault-Meslin, Sanjeet Singh Avtaar Singh, Francesco Nappi, Antonio Fiore. The antegrade reperfusion test avoids the risk of mitral regurgitation recurrence optimizing valve repair[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 939-946.
[13] Xinghui Li, Zhihe Da, Xiaolan Ren, Yan Qiao, Ping Xie, Xiaolong Sun, Lijun Wang, Junxian Han, Yongfeng Hua. Trends and distribution of coronary heart disease mortality rate in Hexi Corridor, Gansu, China from 2006 to 2015[J]. Reviews in Cardiovascular Medicine, 2021, 22(3): 1003-1008.
[14] Janani Rangaswami. Closing gaps in the care of patients with heart-kidney disease: the time is now[J]. Reviews in Cardiovascular Medicine, 2021, 22(2): 257-258.
[15] Melanie McGinlay, Sam Straw, Jacob Jagger, Bako Nouri, John Gierula, Klaus K Witte. Impact of the COVID-19 pandemic on the management of chronic heart failure[J]. Reviews in Cardiovascular Medicine, 2021, 22(2): 271-276.
No Suggested Reading articles found!